login don't have an account, register Subjects
X

Login Form

username/email:
password:

Forgot Password

Evidence of Exposure and Occurrence of Hepatitis C Virus Among Drug Users of Swat, Pakistan

Research

Evidence of Exposure and Occurrence of Hepatitis C Virus Among Drug Users of Swat, Pakistan

Abdul Waheed Khan1* , Fazli Zahir1 , Zeeshan Nasim1,2 , Shakir Khan1 , Ijaz Ali1,3 , Syed Urooj-us-Sadat1 , Sadia Nawab1 , Fahad Ali Shah1 , Ismail Khan1 , Mazhar Khalil1 , Abdul Haleem Khan4 , Muhammad Adil Khan5

1Institute of Biotechnology and Genetic Engineering, The University of Agriculture, Peshawar, Pakistan

2College of Life Sciences and Biotechnology, Korea University, Seoul, Korea

3Department of Biological Sciences, The University of Tulsa, Oklahoma, USA

4Department of Zoology, Islamia College Peshawar, Pakistan

5Australian Research Council, Center of Excellence in Plant Energy Biology, The University of Western Australia, Perth, Australia

To whom correspondence should be addressed. E-mail: khan_ibge@yahoo.com

Abstract

Drug users constitute a leading risk group associated with Hepatitis C infection. In Pakistan, a large number of drug users retain Hepatitis C virus (HCV). In the current study, occurrence of HCV was assessed in drug users of Swat, Pakistan. A total of 128 study subjects were enrolled and anti-HCV screening was carried out clinically. Seropositive samples were analyzed for the presence of viremia. Results indicated seroprevalence in 37.5% and active infection in 24.21% of the included drug users. HCV occurrence was found higher in males (93.54%) as compared to females (P= 0.7822). Age wise, age group 31-45 was found to have the highest (70.96%) HCV occurrence (P= 0.0022). Based on the type of drug users, injection drug users (IDUs) category was found highly affected (58.06%) with HCV infection (P= 0.1346). Awareness programs should be initiated and preventive strategies must be strictly implemented by government and administrative units to curtail the spread of HCV in drug users.

Keywords

HCV, prevalence, drug users, active infection, Swat, Pakistan

Introduction

Hepatitis C is a complex liver infection, with high incidence and mortality. According to an estimate, more than 185 million people are infected with Hepatitis C globally [1], with annual death frequency over 350,000 [2]. In underdeveloped countries, where the living standard of most residents is low, Hepatitis C spread is increasing enormously. Pakistan bears the burden of about 10 million Hepatitis C affected population [3], leaving behind various South Asian countries like Afghanistan, India, Bangladesh, Bhutan and Nepal [1].

The agent responsible for Hepatitis C disease is Hepatitis C virus (HCV), comprising of ssRNA genome and family Flaviviridae. HCV genome consists of 9.6 kb size with three structural and seven non-structural genes [4]. HCV has been classified into six genotypes (1-6) and above hundred subtypes [5].

Drugs users are one of the principal risk groups associated with HCV infection. Worldwide, injection drug users (IDUs) and non-injecting drug users (NIDUs) with HCV infection contribute a major portion of overall HCV incidence [6, 7]. Pakistan lies in the immediate vicinity of Afghanistan, the chief producer of many drugs such as opium and heroin [8, 9]. Due to porous nature of Pak-Afghan border, Pakistani residents face intense vulnerability in terms of drug trafficking and drug abuse [8]. Currently, number of drug users in the country constitute 6% of total population [10], with seroprevalence of approximately 88% among IDUs [11].

Swat comprises one of the northern parts of Khyber Pakhtunkhwa (KP) province of Pakistan. Due to constant wars and natural calamities, no study on HCV status in drug users has been reported from this region during the past few years. Therefore, the present study was undertaken to ascertain the current status of HCV in drug users of this area.

Material and Methods

Study Plan and Sampling

The current study was carried out during February-September 2014 at various hospitals and health care centers, located in district Swat, Pakistan. Prior to initiation, the study plan was duly approved from institutional ethical committee of Institute of Biotechnology and Genetic Engineering (IBGE), The University of Agriculture, Peshawar. Local hospitals were visited for drug users and samples were retrieved (n= 128) with the permission of hospitals administration and consent of the study subjects. Basic demographic data was recorded on a proforma during interview session. Among the total drug users, 121 were males and 7 were females. Serum was isolated and stored for 2-3 days at -20 °C for onward use.

Preliminary Screening

Serum was evaluated for the presence of HCV antibodies using Immuno-chromatographic test (ICT) strips (Acon®, USA). These strips have been previously reported to have high specificity and sensitivity [12]. Seropositive samples were analyzed for the presence of viremia.

RNA Extraction and Reverse Transcription

ICT positive samples were subjected to viral RNA isolation using viral nucleic acid extraction kit (Favorgen®, Taiwan), according to manufacturer guidelines. cDNA was synthesized by using 50-200 ng RNA and 200 units of reverse transcriptase enzyme (MMLV) (Thermoscientific®, USA) at 42 °C for 60 minutes.

Qualitative PCR

Active infection was determined by regular PCR, targeting the 5′ UTR region, using newly designed qualitative sense (QS) and qualitative antisense (QAS) primers (Table 1). A total of 20 μL reaction volume was used, with 2 μL PCR template (cDNA), 2.5 units of Taq DNA polymerase enzyme (Thermoscientific®, USA) and 1 μL (1%) dimethyl sulphoxide (DMSO). Thermal profile was as follows; initial denaturation at 94 °C for 5 minutes, followed by 30 cycles, each of denaturation at 94 °C for 50 seconds, annealing at 58 °C for 40 seconds, extension at 72 °C for 60 seconds and a final extension at 72 °C for 7 minutes.

Primer Name Sequence (5′→ 3′) Tm (°C) Length (bp)
Qualitative Sense (QS) TCCCGGGAGAGCCATAGT 59 18
Qualitative Anti-sense (QAS) ACCCTATCAGGCAGTACCACA 60 21

Table 1 Details of newly designed primers used in qualitative PCR amplification.

Gel Electrophoresis

PCR product of approximately 170 bp was detected on 2% agarose gel in the presence of ultraviolet light trans-illuminator (Figure 1).

Statistical Analysis

The data was analyzed by using IBM-SPSS (version 20) for finding the association of disease prevalence with gender, age and type of drug user via Chi-square test at 0.05 level of significance. Microsoft Excel (version 2010) was used for percentage frequencies and graph diagrams.

Results

Out of total 128 samples, 37.5% (48/128) were found positive for anti-HCV antibodies. Of them, HCV RNA was detected in 24.21% (31/128). Gender wise occurrence revealed males as the predominant category with 93.54% (29/31) HCV infection (P= 0.7822). A statistically significant association was observed among age groups, with highest infection occurrence of 70.96% (22/31) in second age group (31-45) (P= 0.0022). Based on the type of drug users, IDUs was the leading category with 58.06% (18/31) HCV infection. However, the differences among different type of drug users were statistically non-significant (P= 0.1346). Net awareness about precautionary measures was only 16.40% (21/128).

Figure 1: Gel diagram of amplified PCR product. Lane M: 50 bp ladder; Lane 1: Positive Control; Lane 2: Negative Control; Lane 3, 4, 5: PCR Positive samples of 176 bp.

Figure 2: Gender wise HCV occurrence in drug users.

Figure 3: Age wise HCV occurrence in drug users.

Figure 4: HCV occurrence on the basis of type of drug users. NIDUs: Non-injection drug users; IDUs: Injection drug users; MDUs: Multiple drug users.

Discussion

In Pakistan, the status of Hepatitis C is endemic, with high incidence and death rate. Drug users represent a leading risk group associated with HCV infection [11, 13]. This is one of the initial reports on the occurrence of HCV in drug users of Swat, Pakistan. Also, in the present study active infection based occurrence has been evaluated, compared to most studies reporting seroprevalence only [11, 14]. As drug users normally use septic procedures and share contaminated equipment [15, 16], they are highly prone to HCV infection due to contagious nature of the virus. Moreover, lack of knowledge about precautionary measures [11] places them at a higher risk of HCV acquisition.

In the current study, overall high HCV occurrence (24.21%) was observed. The obtained occurrence percentage is relatively greater than a previous provincial study [13]. Nevertheless, study highlighting areas from other provinces such as Lahore and Quetta [17], indicated much higher occurrence of 97.3%, and 67.7% respectively. However, in all those studies the study criteria were solely confined to IDUs.

Gender wise, HCV occurrence revealed males as higher risk (P= 0.7822) than females (Figure 2), a trend obvious in other risk groups [13] and general population too [18]. Likewise, high HCV occurrence in males has been reported in previous studies as well [17]. Comparatively, higher ratio of HCV in male drug users may be attributed to their greater exposure to drugs, due to cultural and social dimensions. Occurrence of HCV was different in different age groups (P= 0.0022), age group 31-45 being the mostly affected (Figure 3), a pattern almost similar to study conducted on different risk groups, however, occurrence in people of old age was highly elevated relative to our findings [14].

In the drug type categories, fluctuating trend was observed with considerable differences in different type of drug users, IDUs being the most elevated (Figure 4); however, these differences were found to be statistically non-significant (P= 0.1346). These findings are in concordance with the previous studies showing much greater prevalence in IDUs [6] as compared to NIDUs [7]. Since HCV is a blood borne virus, pre-used injections and contaminated equipment enhances the transmission probability enormously [15]. In addition, in NIDUs no direct blood contact tools are used; it is the sharing of straw or crack pipes that are associated with viral transmission [16].

Conclusively, high HCV occurrence in drug users is an alarming sign of uncontrolled viral spread. Preventive measures should be imposed on large scale to control dissemination of the virus, which is not only public health concern but also a national economic burden. Most importantly, awareness programs should be conducted by governmental, social and non-governmental organizations to educate the local communities about the menace of HCV.

Acknowledgments

The authors highly acknowledge the technical support of Mr. Zakir Khan during entire study.

Special thanks to the reviewers for their valuable suggestions and recommendations.

Authors Contribution

Study concept and design: AWK. Analysis and interpretation of data: AWK, ZN and FZ. Manuscript preparation: AWK, ZN, FZ and SK. Critical revision of the manuscript for important intellectual content: ZN, FZ and MAK. Technical and material support: SK, SUS, SN, FAS, IK, MK, AHK and MAK. Study supervision: IA.

References

  1. Mohd Hanafiah K, Groeger J, Flaxman AD, Wiersma ST (2013). Global epidemiology of Hepatitis C virus infection: New estimates of age‐specific antibody to HCV seroprevalence. Hepatology, 57(4):1333-42.
  2. Perz JF, Armstrong GL, Farrington LA, Hutin YJ, Bell BP (2006). The contributions of hepatitis B virus and Hepatitis C virus infections to cirrhosis and primary liver cancer worldwide. J Hepatol, 45(4):529-38.
  3. Anjum S, Ali S, Ahmad T, Afzal MS, Waheed Y, Shafi T, et al. (2013). Sequence and structural analysis of 3'untranslated region of Hepatitis C virus, genotype 3a, from pakistani isolates. Hepat Mon, 13(5):e8390.
  4. Lemon S, Walker C, Alter M, Yi M (2007). Hepatitis C virus. Fields virology, 5(1):1253-304.
  5. Martell M, Esteban JI, Quer J, Genescà J, Weiner A, Esteban R, et al. (1992). Hepatitis C virus (HCV) circulates as a population of different but closely related genomes: quasispecies nature of HCV genome distribution. J Virol, 66(5):3225-9.
  6. Nelson PK, Mathers BM, Cowie B, Hagan H, Des Jarlais D, Horyniak D, et al. (2011). Global epidemiology of hepatitis B and Hepatitis C in people who inject drugs: results of systematic reviews. Lancet, 378(9791):571-83.
  7. Scheinmann R, Hagan H, Lelutiu-Weinberger C, Stern R, Des Jarlais DC, Flom PL, et al. (2007). Non-injection drug use and Hepatitis C virus: a systematic review. Drug Alcohol Depend, 89(1):1-12.
  8. Malik A, Sarfaraz SF (2011). Origin and development of drug addiction in South Asia.Pak J Commer Soc Sci, 5(1):155-65.
  9. Strathdee SA, Zafar T, Brahmbhatt H, Baksh A, ul Hassan S (2003). Rise in needle sharing among injection drug users in Pakistan during the Afghanistan war. Drug Alcohol Depend, 71(1):17-24.
  10. United Nation Office on Drug and Crime (UNODC). Drug Use in Pakistan 2013 Survey reveals high levels of drug use and dependency. May 22, 2014:Available from URL: https://www.unodc.org/pakistan/en/drug-use-in-pakistan-2013-survey-reveals-high-levels-of-drug-use-and-dependency.html
  11. Kuo I, Galai N, Thomas D, Zafar T (2015). High HCV seroprevalence and HIV drug use risk behaviors among injection drug users in Pakistan. Harm Reduct J, 3:10.
  12. Hayder I, Ahmed W, Alam SE (2012). Comparison of different ICT Kits for HBsAg and anti-HCV using gold standard ELISA. Pak J Med Res, 51(3):72-76.
  13. Ali I, Siddique L, Rehman LU, Khan NU, Iqbal A, Munir I, et al. (2011). Prevalence of HCV among the high risk groups in Khyber Pakhtunkhwa. Virol J, 8:296.
  14. Memon AR, Shafique K, Memon A, Draz AU, Rauf M, Afsar S (2012). Hepatitis B and C prevalence among the high risk groups of Pakistani population. A cross sectional study. Arch Public Health, 70(1):9.
  15. Verachai V, Phutiprawan T, Theamboonlers A, Chinchai T, Tanprasert S, Haagmans BL, et al. (2002). Prevalence and genotypes of Hepatitis C virus infection among drug addicts and blood donors in Thailand. Southeast Asian J Trop Med Public Health, 33(4):849-51.
  16. Tortu S, McMahon JM, Pouget ER, Hamid R (2004). Sharing of noninjection drug-use implements as a risk factor for Hepatitis C. Subst Use Misuse, 39(2):211-24.
  17. Zafar T, Ahmed MA, Strathdee SA (2006). High HCV seroprevalence and HIV drug use risk behaviors among injection drug users in Pakistan. Harm Reduct J, 3:26.
  18. Ali SA, Donahue RM, Qureshi H, Vermund SH (2009). Hepatitis B and Hepatitis C in Pakistan: prevalence and risk factors. Int J Infect Dis, 13(1):9-19.